miTRATA (MicroRNA Truncation and Tailing Analysis)

This webtool (described in a 2016 paper in Bioinformatics) can be used to find differential 3′ truncation (decay) and tailing (addition of 3' nucleotides) modifications of plant small RNAs; it requires the following inputs:
1. Small RNA sequence files.
2. Genome of interest (aka the bowtie index, which can be selected by drop down – provided in the webtool).
3. List of mature miRNA sequence(s) (FASTA format) from miRBase. A link is provided in our webtool to collect mature miRNA sequence(s) from miRBase.

Tool Revision History: Click here to view the changelog.

Upload the small RNAs and their abundances  Note: Sequences should be in Tag_count format with “tag” preceding “count”; no blank lines separating sequences are permitted. Tag should be separated from count by only 1 TAB.

We have provided users with Python3-based FASTQ preprocessing capabilities to generate “tag count” file(s), and it also yields a FASTQC report and graphs after trimming and chopping (for which the genome sequence must be provided). A step by step guide is provided in README file. Please download the folder from the following link: Github link.

Please select one of the three menu for the tag_count files (max file size =1GB):

(Upload single file in - .txt or .zip)

(Upload multiple files in - .zip or .tar.gz format)

Select example tag count files for running the analysis
     hen1-1-rep1.txt
     hen1-8-rep1.txt

Select the genome to which these sRNAs will be mapped Please select bowtie index for the plant/animal of interest from drop down (Bowtie is already set to Arabidopsis for running example):    


Upload or select the set of microRNAs to analyze Note: Sequences must be in FASTA format with the ">name" proceeding each sequence; no blank lines separating sequences are permitted. Only A, U, C, G, T are allowed. Keep the name of the sequences short to retain optimal quality of the figures. For example, instead of ">osa-miR523f MIMAT0023516 Oryza sativa" as a name for a sequence in the FASTA file, use ">osa-miR818f"

Please select one of the three menu for the miRNA files:

(Upload your miRNA sequence file - .fa file)

Please select the plant/animal from the drop down menu to pick the mature microRNA sequences (from miRBase version 21):   

 Select example of miRNAs for running the analysis
     >ath-miR166a
     TCGGACCAGGCTTCATTCCCC

Tell us where to send you the results Enter your e-mail address to receive results:    



(Optional) Enter the subject to appear on your mail:



    

View sample output using examples


Tailing Analysis Creators
Parth Patel Graduate Assistant Application Development
Deepthi Ramachandruni Technical Specialist Application Development
Atul Kakrana Graduate Assistant Application Development
Mayumi Nakano Computational Manager Application Development
Blake Meyers Principal Investigator Small RNAs

Cite

Patel, P., Ramachandruni, S.D., Kakrana, A., Nakano, M., Meyers, B.C. (2016). miTRATA: a web-based tool for microRNA Truncation and Tailing Analysis. Bioinformatics. 32 (3):450-2. doi: 10.1093/bioinformatics/btv583. PubMed PMID:26454275