miTRATA (MicroRNA Truncation and Tailing Analysis)

This webtool (described in a 2015 paper in Bioinformatics) can be used to find differential 3′ truncation (decay) and tailing (addition of 3' nucleotides) modifications of plant small RNAs; it requires the following inputs:
1. Small RNA sequence files.
2. Genome of interest (aka the bowtie index, which can be selected by drop down – provided in the webtool).
3. List of mature miRNA sequence(s) (FASTA format) from miRBase. A link is provided in our webtool to collect mature miRNA sequence(s) from miRBase.



Upload the small RNAs and their abundances  Note: Sequences should be in Tag_count format with “tag” preceding “count”; no blank lines separating sequences are permitted. Tag should be separated from count by only 1 TAB.

We have provided users with Python3-based FASTQ preprocessing capabilities to generate “tag count” file(s), and it also yields a FASTQC report and graphs after trimming and chopping (for which the genome sequence must be provided). A step by step guide is provided in README file. Please download the folder from the following link: Github link.

Please select one of the three menu for the tag_count files:

(Upload single file in - .txt or compressed .gz format)

(Upload multiple files in - .zip or .tar.gz format)

Select example tag count files for running the analysis
     hen1-1-rep1.txt
     hen1-8-rep1.txt

Select the genome to which these sRNAs will be mapped Please select bowtie index for the plant/animal of interest from drop down (Bowtie is already set to Arabidopsis for running example):    


Upload or select the set of microRNAs to analyze Note: Sequences must be in FASTA format with the ">name" proceeding each sequence; no blank lines separating sequences are permitted. Only A, U, C, G, T are allowed. Keep the name of the sequences short to retain optimal quality of the figures. For example, instead of ">osa-miR523f MIMAT0023516 Oryza sativa" as a name for a sequence in the FASTA file, use ">osa-miR818f"

Please select one of the three menu for the miRNA files:

(Upload your miRNA sequence file - .fa file)

Please select the plant/animal from the drop down menu to pick the mature microRNA sequences (from miRBase version 21):   

 Select example of miRNAs for running the analysis
     >ath-miR166a
     TCGGACCAGGCTTCATTCCCC

Tell us where to send you the results Enter your e-mail address to receive results:    



(Optional) Enter the subject to appear on your mail:



    

View sample output using examples