Arabidopsis Small RNA Target Prediction - Results

Request DetailsPage requested by id: sample@service
Request submitted time: 2010-02-25 01:09:11

Score: <= 2.5   Bulge: 2.0   Mismatch: 1.0   Wobble: 0.5
Filter:
          10/11 nt positions - perfect match required
          2 to 9 nt positions - no more than one mismatch allowed (forces most mismatches into 12 to 21 nt positions)
          Ignore penalty scores for a mismatch at the first (5') position of the small RNA.

Search performed against: Arabidopsis genome (TAIR 10)

Click here to start a new search

Click to jump in the page below to the specific input sequence:
TGACAGAAGAGAGTGAGCAC
TTGACAGAAGATAGAGAGCAC
TGACAGAAGATAGAGAGCAC
TCCCAAATGTAGACAAAGCA
TTTGGATTGAAGGGAGCTCTA


TGACAGAAGAGAGTGAGCAC

# Target Site Alignment Chr Start End Score Mismatch Wobble Insertion Deletion StrandGene Gene Function
1 >> GTGCTCACTCTCTTCTGTCA >> 4 15,074,945 15,074,964 0 0 0 0 0 cAntisense to ath-MIR156b-
2 >> GTGCTCACTCTCTTCTGTCG >> 2 8,412,589 8,412,608 0 0 0 0 0 wAT2G19420
3 >> GTGCTCACTCTCTTCTGTCA >> 2 10,676,534 10,676,553 0 0 0 0 0 wAntisense to ath-MIR156a-
4 >> GTGCTCACTCTCTTCTGTCA >> 5 3,867,213 3,867,232 0 0 0 0 0 cAntisense to ath-MIR156e-
5 >> GTGCTCACTCTCTTCTGTCA >> 5 9,136,126 9,136,145 0 0 0 0 0 cAntisense to AT5G26146-
6 >> GTGCTCACTCTCTTCTGTCA >> 5 3,456,713 3,456,732 0 0 0 0 0 wAntisense to AT5G10946-
7 >> GTGCTCACTCTCTTCTGTCA >> 4 15,415,491 15,415,510 0 0 0 0 0 wAntisense to AT4G31877-
8 >> GTGCTCTCTCTCTTCTGTCA >> 3 21,444,834 21,444,853 1 1 0 0 0 cAT3G57920squamosa promoter binding protein-like 15
9 >> GTGCTCTCTCTCTTCTGTCA >> 5 20,616,080 20,616,099 1 1 0 0 0 cAT5G50670Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein
10 >> GTGCTCTCTCTCTTCTGTCA >> 5 20,582,738 20,582,757 1 1 0 0 0 cAT5G50570Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein
11 >> GTGCTCTCTCTCTTCTGTCA >> 1 9,503,618 9,503,637 1 1 0 0 0 wAT1G27360squamosa promoter-like 11
12 >> GTGCTCTCTCTCTTCTGTCA >> 2 17,589,066 17,589,085 1 1 0 0 0 wAT2G42200unknown function
13 >> GTGCTCTCTCTCTTCTGTCA >> 5 17,360,758 17,360,777 1 1 0 0 0 cAT5G43270squamosa promoter binding protein-like 2
14 >> GTGCTCTCTCTCTTCTGTCA >> 1 26,006,731 26,006,750 1 1 0 0 0 wAT1G69170Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein
15 >> GTGCTCTCTCTCTTCTGTCA >> 1 9,505,541 9,505,560 1 1 0 0 0 cAT1G27370squamosa promoter binding protein-like 10
16 >> TTGCTTACTCTCTTCTGTCA >> 2 14,305,878 14,305,897 1.5 1 1 0 0 wAT2G33810unknown function
17 >> CTGCTCTCTCTCTTCTGTCA >> 1 19,807,090 19,807,109 2 2 0 0 0 wAT1G53160squamosa promoter binding protein-like 4
18 >> GTGTTCACTCTCCTCTGTTT >> 1 5,692,169 5,692,188 2 1 2 0 0 wAT1G16660transposable element gene
19 >> GTACTCACTCTCTTCTTTCG >> 2 16,854,727 16,854,746 2 2 0 0 0 wAntisense to AT2G40360-
20 >> GTGCTCACTCTCTTTTTGTCA >> 5 3,456,647 3,456,667 2.5 0 1 1 0 cAT5G10946
21 >> GTGCTTACTCTCTCTCTGTCA >> 5 3,867,288 3,867,308 2.5 0 1 1 0 wath-MIR156emiRNA
22 >> GTACTCACTCTCTTTTCTCC >> 4 7,051,642 7,051,661 2.5 2 1 0 0 cAT4G11670Protein of unknown function (DUF810)
23 >> ATGTTCACTCTCTTATGTCT >> 3 1,356,034 1,356,053 2.5 2 1 0 0 cAntisense to AT3G04910-
24 >> GTGTTCACTCTCTTATGGCC >> 3 9,189,059 9,189,078 2.5 2 1 0 0 wAT3G25230unknown function
25 >> GTGCTCTCTCTCTTGTGTTT >> 3 21,434,521 21,434,540 2.5 2 1 0 0 wAntisense to AT3G57880-
26 >> GTTCTCACTCTCGTCTGTTT >> 3 6,810,960 6,810,979 2.5 2 1 0 0 wAntisense to AT3G19600-
27 >> GTGCTCTCTCTTTTCTATCA >> 2 18,015,199 18,015,218 2.5 2 1 0 0 cAntisense to AT2G43370-
28 >> GTGCTTACTCTCTTCTTGTCT >> 2 8,412,526 8,412,546 2.5 0 1 1 0 cAntisense to AT2G19420-
29 >> CTGCTCACTCTTTTCTCTCA >> 1 5,174,489 5,174,508 2.5 2 1 0 0 cAT1G15020quiescin-sulfhydryl oxidase 1
30 >> GTTCTCACTCTCTTCTCTTA >> 1 22,722,044 22,722,063 2.5 2 1 0 0 cAT1G61580R-protein L3 B
31 >> GTGCACACTCTCTTTGGTCT >> 5 17,690,555 17,690,574 2.5 2 1 0 0 cAT5G43960Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain
Query (3'-5') << CACGAGTGAGAGAAGACAGT <<


TTGACAGAAGATAGAGAGCAC

# Target Site Alignment Chr Start End Score Mismatch Wobble Insertion Deletion StrandGene Gene Function
1 >> GTGCTCTCTATCTTCTGTCAG >> 1 18,026,989 18,027,009 0 0 0 0 0 wAntisense to ath-MIR157d-
2 >> GTGCTCTCTATCTTCTGTCAA >> 1 24,913,276 24,913,296 0 0 0 0 0 wAntisense to ath-MIR157a-
3 >> GTGCTCTCTATCTTCTGTCAA >> 1 24,921,104 24,921,124 0 0 0 0 0 cAntisense to ath-MIR157b-
4 >> GTGCTCTCTATCTTCTGTCAA >> 3 6,244,673 6,244,693 0 0 0 0 0 wAntisense to ath-MIR157c-
5 >> GTGCTCTCTATTTTCTGTTTG >> 4 15,114,493 15,114,513 2 1 2 0 0 wAT4G31050Biotin/lipoate A/B protein ligase family
6 >> GTGCTCTCTATGCTTCTGTCAT >> 1 18,026,838 18,026,859 2 0 0 1 0 cath-MIR157dmiRNA
7 >> GTGCTCTCTATACTTCTGTCAC >> 3 6,244,528 6,244,549 2 0 0 1 0 cath-MIR157cmiRNA
8 >> TTGCTCTTTATCTTTTGTCGA >> 3 7,265,092 7,265,112 2.5 1 3 0 0 cAT3G20780unknown function
9 >> GAGCTCTCTATCTTTGGTCAT >> 2 14,868,790 14,868,810 2.5 2 1 0 0 cAT2G35320unknown function
10 >> TTGATCTCTATCTTCTGTCGA >> 1 27,239,799 27,239,819 2.5 2 1 0 0 wAntisense to AT1G72350-
11 >> TTACTCTCTATTTTCTGTCAC >> 5 14,068,477 14,068,497 2.5 2 1 0 0 cAT5G35930AMP-dependent synthetase and ligase family protein
Query (3'-5') << CACGAGAGATAGAAGACAGTT <<


TGACAGAAGATAGAGAGCAC

# Target Site Alignment Chr Start End Score Mismatch Wobble Insertion Deletion StrandGene Gene Function
1 >> GTGCTCTCTATCTTCTGTCA >> 1 18,026,989 18,027,008 0 0 0 0 0 wAntisense to ath-MIR157d-
2 >> GTGCTCTCTATCTTCTGTCA >> 3 6,244,673 6,244,692 0 0 0 0 0 wAntisense to ath-MIR157c-
3 >> GTGCTCTCTATCTTCTGTCA >> 1 24,913,276 24,913,295 0 0 0 0 0 wAntisense to ath-MIR157a-
4 >> GTGCTCTCTATCTTCTGTCA >> 1 24,921,105 24,921,124 0 0 0 0 0 cAntisense to ath-MIR157b-
5 >> GTGCTCTCTATTTTCTGTTT >> 4 15,114,493 15,114,512 1 0 2 0 0 wAT4G31050Biotin/lipoate A/B protein ligase family
6 >> GTGCTCTCTATGCTTCTGTCA >> 1 18,026,839 18,026,859 2 0 0 1 0 cath-MIR157dmiRNA
7 >> TTGATCTCTATCTTCTGTCG >> 1 27,239,799 27,239,818 2 2 0 0 0 wAntisense to AT1G72350-
8 >> TTGATCTCTATCTTCTGTCT >> 1 5,928,504 5,928,523 2 2 0 0 0 wAntisense to AT1G17310-
9 >> TTGCTCTCTATCTTCTTTCT >> 4 16,598,658 16,598,677 2 2 0 0 0 wIGR-
10 >> GTGCTCTCTATACTTCTGTCA >> 3 6,244,529 6,244,549 2 0 0 1 0 cath-MIR157cmiRNA
11 >> TTGCTCTTTATCTTTTGTCG >> 3 7,265,093 7,265,112 2 1 2 0 0 cAT3G20780unknown function
12 >> GAGCTCTCTATCTTCCGTTG >> 5 20,391,588 20,391,607 2.5 2 1 0 0 wAT5G50130NAD(P)-binding Rossmann-fold superfamily protein
13 >> ATGTTCTCTATCTTCTTTCT >> 3 7,089,710 7,089,729 2.5 2 1 0 0 cAT3G20320unknown function
14 >> GTGCTCTCTATTTATTGTTT >> 3 2,624,268 2,624,287 2.5 1 3 0 0 wAT3G08640unknown function
15 >> GAGCTCTCTATCTTTGGTCA >> 2 14,868,791 14,868,810 2.5 2 1 0 0 cAT2G35320unknown function
16 >> TTACTCTCTATTTTCTGTCA >> 5 14,068,478 14,068,497 2.5 2 1 0 0 cAT5G35930AMP-dependent synthetase and ligase family protein
Query (3'-5') << CACGAGAGATAGAAGACAGT <<


TCCCAAATGTAGACAAAGCA

# Target Site Alignment Chr Start End Score Mismatch Wobble Insertion Deletion StrandGene Gene Function
1 >> TGCTTTGTCTACATTTGGGG >> 1 20,772,273 20,772,292 0 0 0 0 0 cAntisense to AT1G55591-
2 >> TGCTTTGTCTACATTTGGGA >> 3 3,366,349 3,366,368 0 0 0 0 0 wAntisense to AT3G10745-
3 >> TGCTTTGTCTACATTTGGCA >> 1 23,276,584 23,276,603 1 1 0 0 0 cAT1G62860
4 >> TTCTTTGTCTACATTTGGCA >> 1 23,792,061 23,792,080 2 2 0 0 0 wAT1G64100pentatricopeptide (PPR) repeat-containing protein
5 >> GGCTTTGTCTACATTTGTGG >> 3 2,372,644 2,372,663 2 2 0 0 0 wAntisense to AT3G07410-
6 >> TGCTTGGTCTACATTTGGTT >> 2 968,565 968,584 2 2 0 0 0 cAT2G03210fucosyltransferase 2
7 >> TGCTTGGTCTACATTTGGAT >> 2 970,622 970,641 2 2 0 0 0 cAT2G03220fucosyltransferase 1
8 >> TGCTTTGTCTACATTAGCGA >> 1 4,294,438 4,294,457 2 2 0 0 0 cIGR-
9 >> TGATTTGTCTATATTTGTGT >> 1 26,116,434 26,116,453 2.5 2 1 0 0 cAT1G69480EXS (ERD1/XPR1/SYG1) family protein
10 >> TGCTTTGTTTAAATTGGGGT >> 3 18,494,743 18,494,762 2.5 2 1 0 0 wIGR-
11 >> TGTTTTGTCTATGTTTGGTT >> 3 7,647,667 7,647,686 2.5 1 3 0 0 wIGR-
Query (3'-5') << ACGAAACAGATGTAAACCCT <<


TTTGGATTGAAGGGAGCTCTA

# Target Site Alignment Chr Start End Score Mismatch Wobble Insertion Deletion StrandGene Gene Function
1 >> TAGAGCTCCCTTCAATCCAAA >> 1 27,713,234 27,713,254 0 0 0 0 0 wAntisense to ath-MIR159a-
2 >> AAGAGCTCCCTTCAATCCAAA >> 1 6,220,813 6,220,833 1 1 0 0 0 cAntisense to ath-MIR159b-
3 >> TGGAGCTCCCTTCATTCCAAT >> 3 3,604,151 3,604,171 1.5 1 1 0 0 wAT3G11440unknown function
4 >> TAGAGCTTCCTTCAAACCAAA >> 2 13,783,168 13,783,188 1.5 1 1 0 0 cAT2G32460unknown function
5 >> TGGAGCTCCCTTCATTCCAAG >> 2 11,501,206 11,501,226 1.5 1 1 0 0 cAT2G26950myb domain protein 104
6 >> AGGAGCTCCCTTCAATCCAAA >> 2 18,994,826 18,994,846 1.5 1 1 0 0 cAntisense to AT2G46255-
7 >> TGGAGCTCCCTTCATTCCAAT >> 5 1,839,579 1,839,599 1.5 1 1 0 0 wAT5G06100myb domain protein 33
8 >> AGGAGCTCCCTTCAGTCCAAA >> 2 17,029,869 17,029,889 2 1 2 0 0 cAntisense to AT2G40805-
9 >> TAGAGCCCCCTTCAAACCAAA >> 2 14,369,392 14,369,412 2 2 0 0 0 wAT2G34010unknown function
10 >> GGGAGCTCCCTTCAGTCCAAT >> 4 12,353,108 12,353,128 2 1 2 0 0 cAntisense to AT4G23713-
11 >> GGGAGCTCCCTTCAGTCCAAG >> 5 16,660,470 16,660,490 2 1 2 0 0 wAntisense to AT5G41663-
12 >> TAGAGCTCTCTTAAGTCTAAA >> 3 22,851,115 22,851,135 2.5 1 3 0 0 cAT3G61740SET domain protein 14
Query (3'-5') << ATCTCGAGGGAAGTTAGGTTT <<


Download your input file
Download the CleaveLand results as flat file
Download Excel sheet for all the results